Example Responses¶

The following examples show the full JSON responses returned by the Targeton API for each supported workflow.

Screen Pellet Response¶

Request: GET /targeton?name=GREB_A_4_pel370

{
  "library_type": "screen",
  "targeton_text_value": "GREB",
  "targeton_api_id": "seq_ru5QRqxI",
  "replicate": "A",
  "pellet_day": "4",
  "consequences_link": null,
  "valiant_output_link": null,
  "GREB": {
    "LibAmp_F": "GCCCTTGCTCTTCCTTTAGATTGA",
    "LibAmp_R": "TTAAGGATTTAGAATGCCCAAGAGC"
  }
}

Key points:

• library_type is screen because the name matched a Screen Pellet record.
• replicate and pellet_day are populated from the Screen Pellet metadata.
• The GREB object contains the resolved LibAmp forward and reverse primer sequences.
• consequences_link and valiant_output_link are null because they have not yet been configured in Benchling for this Targeton.

HDR Vector Response¶

Request: GET /targeton?name=IVAR_hdr086

{
  "library_type": "plasmid",
  "targeton_text_value": "IVAR",
  "targeton_api_id": "seq_lFOfGMDm",
  "replicate": null,
  "pellet_day": null,
  "consequences_link": null,
  "valiant_output_link": null,
  "IVAR": {
    "LibAmp_F": "GCCCTTGCTCTTCCTTTAGATTGA",
    "LibAmp_R": "TTAAGGATTTAGAATGCCCAAGAGC"
  }
}

Key points:

• library_type is plasmid because no Screen Pellet was found and the name matched an HDR Vector Lot.
• replicate and pellet_day are null because these fields are not applicable to the HDR Vector workflow.
• The IVAR object contains the resolved LibAmp forward and reverse primer sequences.

Notes on the Response Shape¶

• The dynamic named object (e.g., GREB, IVAR) always uses the targeton_text_value as its key.
• consequences_link and valiant_output_link will be populated once the corresponding artefacts have been registered in Benchling.
• If a Targeton has only one primer sequence available, the corresponding LibAmp_F or LibAmp_R field may be null.