Download OpenAPI specification:
The MAVE Platform API provides an interface for retrieving Targeton metadata and associated LibAmp primer sequences from Benchling, as well an interface for retrieving sample data from a sequencing run.
The API abstracts multiple underlying endpoints and returns a harmonised response for downstream MAVE workflows and QC processes.
Consumers only need to provide a single supplier_name value for the Targeton endpoint and a run_id value for the sample endpoint. The API handles all downstream
orchestration and data aggregation automatically.
Obtain an OAuth2 access token using the client credentials grant.
| grant_type required | string Value: "client_credentials" |
| client_id required | string |
| client_secret required | string <password> |
| scope | string |
{- "access_token": "eyJhbGciOi...",
- "token_type": "Bearer",
- "expires_in": 3600,
- "scope": "mave/read"
}Retrieves Targeton metadata and associated LibAmp primer sequences from Benchling for a given entity name.
The API searches the Screen Pellet schema first. If no match is found it falls back to the HDR Vector Lot schema. It then resolves the Targeton Oligo Library (selecting the highest version) and the LibAmp Primer records associated with the resolved Targeton.
| supplier_name required | string Example: supplier_name=GREB_A_4_pel370 Benchling entity supplier name — either a Screen Pellet supplier name (e.g. |
{- "library_type": "screen",
- "targeton_text_value": "GREB",
- "targeton_api_id": "seq_ru5QRqxI",
- "replicate": "A",
- "pellet_day": "4",
- "consequences_link": null,
- "valiant_output_link": null,
- "LibAmp_F": "GCCCTTGCTCTTCCTTTAGATTGA",
- "LibAmp_R": "TTAAGGATTTAGAATGCCCAAGAGC"
}Retrieves sample metadata from the Multi LIMS Warehouse (MLWH) for the supplied sequencing run ID(s).
The API validates the request, normalises the run ID inputs, executes a parameterised SQL query against MLWH, and returns a harmonised JSON response containing sample and sequencing metadata.
Supports multiple run IDs in a single request via a comma-separated run_ids
parameter. Results can be paginated using limit and offset.
| run_ids required | string Example: run_ids=?run_ids=50955&run_ids=50956 Run ID(s) to retrieve sample metadata for. Can be repeated for multiple run IDs. |
| limit | integer >= 1 Example: limit=100 Maximum number of sample records to return. Defaults to the API default if omitted. |
| offset | integer >= 0 Example: offset=0 Pagination offset — the number of records to skip before returning results. Defaults to |
{- "samples": [
- {
- "id_study_lims": "12345",
- "id_run": 50955,
- "name": "Sample_001",
- "supplier_name": "SUPP_001",
- "sequencing_technology": "element",
- "irods_root_collection": "/seq/warehouse",
- "irods_data_relative_path": "runs/50955/sample_001.fastq.gz",
- "paired_read": 1,
- "num_reads": 13278348,
- "lane": 2
}, - {
- "id_study_lims": "12345",
- "id_run": 50955,
- "name": "Sample_002",
- "supplier_name": "SUPP_002",
- "sequencing_technology": "element",
- "irods_root_collection": "/seq/warehouse",
- "irods_data_relative_path": "runs/50955/sample_002.fastq.gz",
- "paired_read": 1,
- "num_reads": 13278348,
- "lane": 3
}
], - "limit": 100,
- "offset": 0,
- "count": 2
}